LacO insertions

Use search box to limit strains to chromosomes (LG1, LG2, LG3, LG4, LG5 or LGX) or resistance marker (PuroR, NeoR).

Each strain has been tested for antibiotic resistance but not for LacI binding. Please note that the lacO insertions were put into a strain with the syIs46 insertion. This insertion has both LacI-GFP but also lacO sites. The brightest spot present in these strains are therefore from the syIs46 array integration and the dimmer spot from the 256x lacO miniMos insertion (thank you to Peter Meister for clarifying this). It is highly recommended to outcross 256x lacO from syIs46 for use as a chromosomal marker.

Please request strains from the CGC.
Strain column has link to the strain info at the CGC.

If you find the strains useful then please cite “Frøkjær-Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, LaBella M, Pozniakovski A, Moerman DG and Jorgensen EM. Random and targeted transgene insertion in C. elegans using a modified Mos1 transposon. Nature Methods. (In press)”.

Chr.	Genetic pos.	Position (WB230)	Cargo	Allele	Strain	Insertion marker(s)	Genotype	Flanking sequence	Comments
LG3	III:-26.98	118,056	256x LacO and NeoR	oxTi467	EG7522	cb-unc-119(+) and NeoR	syIs46 II; unc-119(ed3) III oxTi467 III	TACATCATAGCCTGATCCT
LG1	I:-19.15	147,105	256x LacO and NeoR	oxTi468	EG7523	cb-unc-119(+) and NeoR	oxTi468 I ; syIs46 II; unc-119(ed3) III	TATCTTTGTCACTCAGACGTTCCACAAGTT
LG4	IV:14.38	15,809,942	256x LacO and NeoR	oxTi469	EG7524	cb-unc-119(+) and NeoR	syIs46 II; unc-119(ed3) III ; oxTi469 IV	TAAGATTTAATTGTTAAAAAAAAGCCCTAA
LG2	II:-0.39	6,267,597	256x LacO and PuroR	oxTi470	EG7525	cb-unc-119(+) and PuroR	oxTi470 II syIs46 II; unc-119(ed3) III	TATTTGTCAACTGAAATTTATCATTTTTTA
LG2	II:10.59	12,635,479	256x LacO and PuroR	oxTi471	EG7526	cb-unc-119(+) and PuroR	oxTi471 II ; syIs46 II; unc-119(ed3) III	TAGAACTTCAAGACGCGAACCTTGAAAAAA
LG2	II:24.11	15,142,879	256x LacO and PuroR	oxTi472	EG7527	cb-unc-119(+) and PuroR	oxTi472 II ; syIs46 II; unc-119(ed3) III	TAATGTATTTTAATACAGAATAGTCTCGAG
LG2	II:-0.58	6,074,479	256x LacO and PuroR	oxTi473	EG7528	cb-unc-119(+) and PuroR	oxTi473 II ; syIs46 II; unc-119(ed3) III	TAATATGACAATTAGTAGTCATATGGATGC
LG5	V:24.97	20,209,942	256x LacO and PuroR	oxTi474	EG7529	cb-unc-119(+) and PuroR	syIs46 II ; unc-119(ed3) III ; oxTi474 IV	TAAATGATTGAACAGATTCTTTGTTTTGAA
LG5	V:-19.85	1,245,918	256x LacO and PuroR	oxTi475	EG7530	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi475 V	TATATGTACATATTATTCTCATAAATCTCA
LG5	V:2.83	10,899,001	256x LacO and PuroR	oxTi476	EG7531	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi476 V	TATTACTTTTCTAAAGTTTTCAAGAATAAA
LG4	IV:3.59	8,033,901	256x LacO and PuroR	oxTi477	EG7532	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi477 IV	TACATAAAAAATACTCATTGATTAATTGGT
LG5	V:4.62	12,728,334	256x LacO and PuroR	oxTi478	EG7533	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi478 V	TAATACAAAAAATTCGATATTTTACTCAAA
LG1	I:-21.83	4,915	256x LacO and PuroR	oxTi479	EG7541	cb-unc-119(+) and PuroR	oxTi479 I ; syIs46 II; unc-119(ed3) III	TACTACACGTGGGCAAGTTTATACAGTTTT
LG2	II:-5.64	4,063,707	256x LacO and PuroR	oxTi480	EG7534	cb-unc-119(+) and PuroR	oxTi480 II syIs46 II; unc-119(ed3) III	TATCTTATCGTATGAATTGTGTCCGTTTCT
LG1	I:2.10	7,530,607	256x LacO and PuroR	oxTi481	EG7535	cb-unc-119(+) and PuroR	oxTi481 I ; syIs46 II; unc-119(ed3) III	TAATTGTTGGAGCAATTGTTGTCCTTGGTT
LG4	IV:4.03	9,080,905	256x LacO and PuroR	oxTi482	EG7536	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi482 IV	TAAATAATTTGATTCTTTTAAGACAATTAT
LGX	X:7.04	12,405,642	256x LacO and PuroR	oxTi483	EG7477	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi483 X	TATCCAGCCCGACGAGTCTAGTAGTGGATA
LG3	III:3.96	10,613,761	256x LacO and PuroR	oxTi485	EG7538	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III Ti485 III	TATATCAATTGGGAATGCACGGAAATTTAA
LG5	V:-17.21	1,810,279	256x LacO and PuroR	oxTi486	EG7539	cb-unc-119(+) and PuroR	syIs46 II; unc-119(ed3) III ; oxTi486 V	TATGTATTAAGTTGGCCTATATACCAAGTT	This strain may be sick (sterility and lack of GFP noted by Rog lab)
LGX	X:21.84	15,091,074	256x LacO and PuroR	oxTi487	EG7478	cb-unc-119(+) and PuroR	syIs46 II ; unc-119(ed3) III ; oxTi487 X	TAGTGAAAGAAACGCTAGGAGAAGATACTG